Clone info
System ID Symbol Synonyms Species Has StopCodon Categories
JHU05957 ATF7 ATFA Homo sapiens Yes Kinases; Nuclear Proteins; Transcription Factors

HuProt v2.0
Block Row Column Clone
1 8 21 JHU05957
1 8 22 JHU05957
HuProt v3.0
Block Row Column Clone
7 31 1 JHU05957
7 32 1 JHU05957
HuProt v3.1
Block Row Column Clone
7 31 1 JHU05957
7 32 1 JHU05957

External Database ID

Nucleotide (354bp)

>JHU05957
ATGGGAGACGACAGACCGTTTGTGTGCAATGCCACGGGCTGTGGACAGAGATTTACAAACGAGGACCACCTGGCAGTTCA
TAAACACAAGCATGAGATGACATTGAAATTTGGCCCAGCCCGAACTGATTCAGTCATCATTGCAGATCAAACGCCTACTC
CAACTAGATTCCTGAAGAACTGTGAGGAGGTGGGACTCTTCAATGAACTAGCTAGCTCCTTTGAACATGAATTCAAGAAA
GCTGCAGATGAGGATGAGAAAAAGGCAAGAAGCAGGACTGTTGCCAAAAAACTGGTGGTATTCAGACCTAGGCTATTTTT
ATTGTGCTTTGGGATAATTTTCTTAATTGGTTAG

Protein (117aa)

>JHU05957
MGDDRPFVCNATGCGQRFTNEDHLAVHKHKHEMTLKFGPARTDSVIIADQTPTPTRFLKNCEEVGLFNELASSFEHEFKK
AADEDEKKARSRTVAKKLVVFRPRLFLLCFGIIFLIG