Clone info
System ID Symbol Synonyms Species Has StopCodon Categories
JHU00012 CCL2 MCP1;SCYA2 Homo sapiens Yes Kinases; Secreted Proteins; Signal Transduction

HuProt v2.0
Block Row Column Clone
20 1 3 JHU00012
20 1 4 JHU00012
HuProt v3.0
Block Row Column Clone
4 5 2 JHU00012
4 6 2 JHU00012
HuProt v3.1
Block Row Column Clone
4 5 2 JHU00012
4 6 2 JHU00012

External Database ID

Nucleotide (300bp)

>JHU00012
ATGAAAGTCTCTGCCGCCCTTCTGTGCCTGCTGCTCATAGCAGCCACCTTCATTCCCCAAGGGCTCGCTCAGCCAGATGC
AATCAATGCCCCAGTCACCTGCTGTTATAACTTCACCAATAGGAAGATCTCAGTGCAGAGGCTCGCGAGCTATAGAAGAA
TCACCAGCAGCAAGTGTCCCAAAGAAGCTGTGATCTTCAAGACCATTGTGGCCAAGGAGATCTGTGCTGACCCCAAGCAG
AAGTGGGTTCAGGATTCCATGGACCACCTGGACAAGCAAACCCAAACTCCGAAGACTTAG

Protein (99aa)

>JHU00012
MKVSAALLCLLLIAATFIPQGLAQPDAINAPVTCCYNFTNRKISVQRLASYRRITSSKCPKEAVIFKTIVAKEICADPKQ
KWVQDSMDHLDKQTQTPKT